Tues: - Pick Groups
- Review Story Part of Project
- Review Poster Part of Project
- Pick Groups / Group project work time
Homework:
- Bring materials for lass work time tomorrow this should include your poster!
Wed: Class project work time. Your poster should be basically done by the end of the day. The
classroom will be ope during lunch and for 30 min after school to work on projects.
Thurs: - Posters Due
- Typed Story Due
- Start presentations
Fri: - Finish Presentations
Tuesday, December 18, 2012
Thursday, December 13, 2012
Cell Organelle Webquest (Friday 12/14)
Introduction
Task
The trip'll be bee's knees.
Procedure
To copy paste the chart:
- open document
- right click - copy image
- paste into word
- use text boxes to fill out chart
(this is only one option to complete the ws. you can hand write it, type it out, its up to you. Just make sure its in your NB on monday.)
Resources
Ya' can't go anywhere
without a guide. Make sure ya' look at the information below. That'll
keep ya' from getting up a gum tree. Crikey, I don't know how I could
guide ya' without them.
The Virtual Cell - The Virtual Cell is an online Cell Biology textbook. It provides students with an interactive journey through the cell.
Animal Cell Interactive - Explore an animal cell.
Animal Cells - The schematic represents an idealized animal cell, e.g., a liver
cell. The columns to the left and right of the labels contain links to
discussions of the particular structures.
Cells and Organelles - An overview of plant and animal cells.
Thurs. Dec. 13th
Cell Organelle Functions
Agenda:
1.) Check homework (Cell Vocab)
2.) Set up questions and chart for "Discovering Cells" Video
3.) Watch video and fill in chart/ answer questions
4.) A view of a Cell Worksheet (Due tomorrow)
If you were absent: Use the links above to watch the video and do the chart.
Video Questions/ Chart:
1.) Cell theory states that "all cells come from _________________."
2.) Give one difference between an elelctron microscope and a light microscope.
Organelle Function chart: (fill out function (job) of each organelle on the chart)
Organelle | Function
------------------------------------------------------
1 cell membrane
2 nucleus
3 mitochondria
4 ribosome
5 ER
6 Golgi
7 lysosome
8 cytoplasm
9 cilia/flagella
Agenda:
1.) Check homework (Cell Vocab)
2.) Set up questions and chart for "Discovering Cells" Video
3.) Watch video and fill in chart/ answer questions
4.) A view of a Cell Worksheet (Due tomorrow)
If you were absent: Use the links above to watch the video and do the chart.
Video Questions/ Chart:
1.) Cell theory states that "all cells come from _________________."
2.) Give one difference between an elelctron microscope and a light microscope.
Organelle Function chart: (fill out function (job) of each organelle on the chart)
Organelle | Function
------------------------------------------------------
1 cell membrane
2 nucleus
3 mitochondria
4 ribosome
5 ER
6 Golgi
7 lysosome
8 cytoplasm
9 cilia/flagella
Wednesday, December 12, 2012
Wed. Dec. 12th
Cell Vocab
- Each of the following terms should be defined in notebook
- Highlighted words require a picture for credit (drawn or printed and glued ok)
1. Cytoplasm
2. Nucleus
3. Nucleolus (not available in class book - will need to look up as homework)
4. Vacuole
5. Lysosome
6. Cytoskeleton
7. Microfilament
8. microtubule
9. centriole
10. ribosome
11. Endoplasmic Reticulum
12. Golgi Apparatis
13. Chloroplast
14. Mitochondria
15. Cell Wall
16. Cell Membrane (Plasma Membrane)
17. Cell
18. Organelle
19. chromatin
20. flagellum
21. cilia/ cilium
22. Prokaryotic
23. Eukaryotic
- Each of the following terms should be defined in notebook
- Highlighted words require a picture for credit (drawn or printed and glued ok)
1. Cytoplasm
2. Nucleus
3. Nucleolus (not available in class book - will need to look up as homework)
4. Vacuole
5. Lysosome
6. Cytoskeleton
7. Microfilament
8. microtubule
9. centriole
10. ribosome
11. Endoplasmic Reticulum
12. Golgi Apparatis
13. Chloroplast
14. Mitochondria
15. Cell Wall
16. Cell Membrane (Plasma Membrane)
17. Cell
18. Organelle
19. chromatin
20. flagellum
21. cilia/ cilium
22. Prokaryotic
23. Eukaryotic
Tuesday, December 11, 2012
Thursday, December 6, 2012
Thurs. Dec. 6th - Mon Dec. 10th
Transformation Lab!!!
In this experiment we will be creating a transgenic organism in our lab. We will be taking the genes from glowing organisms (jellyfish and coral) and putting them into bacteria to make GLOWING BACTERIA!
Agenda:
Thurs: Background Info (Pre-lab done in class or finished at lunch)
Fri: Lab Day (yay!)
Mon: results
Pre Lab: YOU CANNOT DO THE LAB WITHOUT A FINISHED PRE-LAB. NO EXCEPTIONS.
Title: Bacterial Transformation
Objective: To perform and observe the process of bacterial transformation
Procedure: (copy from below)
Pre-lab questions:
1.) What does the Ampicillin do? How do we know what plate has ampicillin on it?
2.) What genes or on the plasmid?
3.) What does the "+" and the "-" mean on the tubes?
In this experiment we will be creating a transgenic organism in our lab. We will be taking the genes from glowing organisms (jellyfish and coral) and putting them into bacteria to make GLOWING BACTERIA!
Agenda:
Thurs: Background Info (Pre-lab done in class or finished at lunch)
Fri: Lab Day (yay!)
Mon: results
Pre Lab: YOU CANNOT DO THE LAB WITHOUT A FINISHED PRE-LAB. NO EXCEPTIONS.
Title: Bacterial Transformation
Objective: To perform and observe the process of bacterial transformation
Procedure: (copy from below)
Pre-lab questions:
1.) What does the Ampicillin do? How do we know what plate has ampicillin on it?
2.) What genes or on the plasmid?
3.) What does the "+" and the "-" mean on the tubes?
Tuesday, December 4, 2012
Tues. Dec. 4th
PCR Results and Genetic Counseling
Agenda:
1.) Return PCR results
2.) Analysis of your DNA results
3.) Continue Gena Lab (Genetic Counseling)
Agenda:
1.) Return PCR results
2.) Analysis of your DNA results
3.) Continue Gena Lab (Genetic Counseling)
Sunday, December 2, 2012
What's up with Gena (Bioinformatiocs)
Bio- informatics Webquest
Today you and a partner will be completing a webquest that will lead you to the results of Gina's medical tests. Is your hypothesis correct? Let's find out!
Before you start:
-Make sure you wrote your groups hypothesis on the top of your worksheet.
Is Gena's type of cancer caused by genetics or something in her environment? Explain your answer.
Procedure:
Part 1:
1.) Gina had a family history of cancer, but did she get cancer from her genes or because of the environment? To test for this possibility DNA was taken and after PCR was done a gel electrophoresis was run. Go to the virtual gel electrophoresis lab. When you are done raise your hand and get credit. (Stamp on your worksheet)
Part 2:
2.) Look at Gena's DNA: (See Below)
a. Draw the gel that would result from the bands given in the link above on your worksheet. Hint: Each number represents a line on a gel for that piece of DNA.
b. Analysis of DNA electrophoresis has reviled that DNA fragments smaller than 300 base
pairs may indicate the presence of genes that have been identified in cancer research.
Does it appear from you electrophoresis model that Gena may have a cancer gene?
Explain your answer. - Write your answer next to your drawing.
Part 3:
Use Gina's DNA sequence in a BLAST search to find out what her DNA is trying to tell us.
Gina's DNA:
TAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCACACTGGA
How to run a BLAST Search:
1. Log into the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST (right side under "popular resources"
3. Under BLAST Assembled Genomes, choose the word "human"
4. In the large box enter the entire sequence from Gina's DNA (copy and paste Gena's DNA)
5. Scroll Down and click "Blast"
6. A new screen will come up. At this point you should click "View these results in the new enhanced report" (upper right hand side)
7. A new screen will appear showing you the results of the search. You should see information concerning the species and chromosome number that Gina's DNA sequence search matched (You don't have to worry about this info).
8. Scroll down to the word "Alignments" just below descriptions.
9. Under the words "Features:" you should find an important piece of information for determining if Gina's 160 base pair sequence matches any known DNA sequences. Do you see what the important clue is? If so write it down on your worksheet.
Congratulations you have finished with the BLAST search.
Complete the analysis questions on your worksheet and turn it in for you and your partner.
Finished Early? Turn in your worksheet.
- Penalty Shootout (Soccer): Reviews History and Biotech Applications
- Hoop Shoot (Basketball): Reviews History and Biotech Applications
- Grade or no Grade (Deal or No Deal): Review History and Biotech Applications
- Protein Synthesis Race :Central Dogma Review
Today you and a partner will be completing a webquest that will lead you to the results of Gina's medical tests. Is your hypothesis correct? Let's find out!
Before you start:
-Make sure you wrote your groups hypothesis on the top of your worksheet.
Is Gena's type of cancer caused by genetics or something in her environment? Explain your answer.
Procedure:
Part 1:
1.) Gina had a family history of cancer, but did she get cancer from her genes or because of the environment? To test for this possibility DNA was taken and after PCR was done a gel electrophoresis was run. Go to the virtual gel electrophoresis lab. When you are done raise your hand and get credit. (Stamp on your worksheet)
Part 2:
2.) Look at Gena's DNA: (See Below)
a. Draw the gel that would result from the bands given in the link above on your worksheet. Hint: Each number represents a line on a gel for that piece of DNA.
b. Analysis of DNA electrophoresis has reviled that DNA fragments smaller than 300 base
pairs may indicate the presence of genes that have been identified in cancer research.
Does it appear from you electrophoresis model that Gena may have a cancer gene?
Explain your answer. - Write your answer next to your drawing.
Part 3:
Use Gina's DNA sequence in a BLAST search to find out what her DNA is trying to tell us.
Gina's DNA:
TAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCACACTGGA
How to run a BLAST Search:
1. Log into the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST (right side under "popular resources"
3. Under BLAST Assembled Genomes, choose the word "human"
4. In the large box enter the entire sequence from Gina's DNA (copy and paste Gena's DNA)
5. Scroll Down and click "Blast"
6. A new screen will come up. At this point you should click "View these results in the new enhanced report" (upper right hand side)
7. A new screen will appear showing you the results of the search. You should see information concerning the species and chromosome number that Gina's DNA sequence search matched (You don't have to worry about this info).
8. Scroll down to the word "Alignments" just below descriptions.
9. Under the words "Features:" you should find an important piece of information for determining if Gina's 160 base pair sequence matches any known DNA sequences. Do you see what the important clue is? If so write it down on your worksheet.
Congratulations you have finished with the BLAST search.
Complete the analysis questions on your worksheet and turn it in for you and your partner.
Finished Early? Turn in your worksheet.
- Penalty Shootout (Soccer): Reviews History and Biotech Applications
- Hoop Shoot (Basketball): Reviews History and Biotech Applications
- Grade or no Grade (Deal or No Deal): Review History and Biotech Applications
- Protein Synthesis Race :Central Dogma Review
Subscribe to:
Posts (Atom)




