Today you and a partner will be completing a webquest that will lead you to the results of Gina's medical tests. Is your hypothesis correct? Let's find out!
Before you start:
-Make sure you wrote your groups hypothesis on the top of your worksheet.
Is Gena's type of cancer caused by genetics or something in her environment? Explain your answer.
Procedure:
Part 1:
1.) Gina had a family history of cancer, but did she get cancer from her genes or because of the environment? To test for this possibility DNA was taken and after PCR was done a gel electrophoresis was run. Go to the virtual gel electrophoresis lab. When you are done raise your hand and get credit. (Stamp on your worksheet)
Part 2:
2.) Look at Gena's DNA: (See Below)
a. Draw the gel that would result from the bands given in the link above on your worksheet. Hint: Each number represents a line on a gel for that piece of DNA.
b. Analysis of DNA electrophoresis has reviled that DNA fragments smaller than 300 base
pairs may indicate the presence of genes that have been identified in cancer research.
Does it appear from you electrophoresis model that Gena may have a cancer gene?
Explain your answer. - Write your answer next to your drawing.
Part 3:
Use Gina's DNA sequence in a BLAST search to find out what her DNA is trying to tell us.
Gina's DNA:
TAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCACACTGGA
How to run a BLAST Search:
1. Log into the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST (right side under "popular resources"
3. Under BLAST Assembled Genomes, choose the word "human"
4. In the large box enter the entire sequence from Gina's DNA (copy and paste Gena's DNA)
5. Scroll Down and click "Blast"
6. A new screen will come up. At this point you should click "View these results in the new enhanced report" (upper right hand side)
7. A new screen will appear showing you the results of the search. You should see information concerning the species and chromosome number that Gina's DNA sequence search matched (You don't have to worry about this info).
8. Scroll down to the word "Alignments" just below descriptions.
9. Under the words "Features:" you should find an important piece of information for determining if Gina's 160 base pair sequence matches any known DNA sequences. Do you see what the important clue is? If so write it down on your worksheet.
Congratulations you have finished with the BLAST search.
Complete the analysis questions on your worksheet and turn it in for you and your partner.
Finished Early? Turn in your worksheet.
- Penalty Shootout (Soccer): Reviews History and Biotech Applications
- Hoop Shoot (Basketball): Reviews History and Biotech Applications
- Grade or no Grade (Deal or No Deal): Review History and Biotech Applications
- Protein Synthesis Race :Central Dogma Review
No comments:
Post a Comment