Tues: - Pick Groups
- Review Story Part of Project
- Review Poster Part of Project
- Pick Groups / Group project work time
Homework:
- Bring materials for lass work time tomorrow this should include your poster!
Wed: Class project work time. Your poster should be basically done by the end of the day. The
classroom will be ope during lunch and for 30 min after school to work on projects.
Thurs: - Posters Due
- Typed Story Due
- Start presentations
Fri: - Finish Presentations
Tuesday, December 18, 2012
Thursday, December 13, 2012
Cell Organelle Webquest (Friday 12/14)
Introduction
Task
The trip'll be bee's knees.
Procedure
To copy paste the chart:
- open document
- right click - copy image
- paste into word
- use text boxes to fill out chart
(this is only one option to complete the ws. you can hand write it, type it out, its up to you. Just make sure its in your NB on monday.)
Resources
Ya' can't go anywhere
without a guide. Make sure ya' look at the information below. That'll
keep ya' from getting up a gum tree. Crikey, I don't know how I could
guide ya' without them.
The Virtual Cell - The Virtual Cell is an online Cell Biology textbook. It provides students with an interactive journey through the cell.
Animal Cell Interactive - Explore an animal cell.
Animal Cells - The schematic represents an idealized animal cell, e.g., a liver
cell. The columns to the left and right of the labels contain links to
discussions of the particular structures.
Cells and Organelles - An overview of plant and animal cells.
Thurs. Dec. 13th
Cell Organelle Functions
Agenda:
1.) Check homework (Cell Vocab)
2.) Set up questions and chart for "Discovering Cells" Video
3.) Watch video and fill in chart/ answer questions
4.) A view of a Cell Worksheet (Due tomorrow)
If you were absent: Use the links above to watch the video and do the chart.
Video Questions/ Chart:
1.) Cell theory states that "all cells come from _________________."
2.) Give one difference between an elelctron microscope and a light microscope.
Organelle Function chart: (fill out function (job) of each organelle on the chart)
Organelle | Function
------------------------------------------------------
1 cell membrane
2 nucleus
3 mitochondria
4 ribosome
5 ER
6 Golgi
7 lysosome
8 cytoplasm
9 cilia/flagella
Agenda:
1.) Check homework (Cell Vocab)
2.) Set up questions and chart for "Discovering Cells" Video
3.) Watch video and fill in chart/ answer questions
4.) A view of a Cell Worksheet (Due tomorrow)
If you were absent: Use the links above to watch the video and do the chart.
Video Questions/ Chart:
1.) Cell theory states that "all cells come from _________________."
2.) Give one difference between an elelctron microscope and a light microscope.
Organelle Function chart: (fill out function (job) of each organelle on the chart)
Organelle | Function
------------------------------------------------------
1 cell membrane
2 nucleus
3 mitochondria
4 ribosome
5 ER
6 Golgi
7 lysosome
8 cytoplasm
9 cilia/flagella
Wednesday, December 12, 2012
Wed. Dec. 12th
Cell Vocab
- Each of the following terms should be defined in notebook
- Highlighted words require a picture for credit (drawn or printed and glued ok)
1. Cytoplasm
2. Nucleus
3. Nucleolus (not available in class book - will need to look up as homework)
4. Vacuole
5. Lysosome
6. Cytoskeleton
7. Microfilament
8. microtubule
9. centriole
10. ribosome
11. Endoplasmic Reticulum
12. Golgi Apparatis
13. Chloroplast
14. Mitochondria
15. Cell Wall
16. Cell Membrane (Plasma Membrane)
17. Cell
18. Organelle
19. chromatin
20. flagellum
21. cilia/ cilium
22. Prokaryotic
23. Eukaryotic
- Each of the following terms should be defined in notebook
- Highlighted words require a picture for credit (drawn or printed and glued ok)
1. Cytoplasm
2. Nucleus
3. Nucleolus (not available in class book - will need to look up as homework)
4. Vacuole
5. Lysosome
6. Cytoskeleton
7. Microfilament
8. microtubule
9. centriole
10. ribosome
11. Endoplasmic Reticulum
12. Golgi Apparatis
13. Chloroplast
14. Mitochondria
15. Cell Wall
16. Cell Membrane (Plasma Membrane)
17. Cell
18. Organelle
19. chromatin
20. flagellum
21. cilia/ cilium
22. Prokaryotic
23. Eukaryotic
Tuesday, December 11, 2012
Thursday, December 6, 2012
Thurs. Dec. 6th - Mon Dec. 10th
Transformation Lab!!!
In this experiment we will be creating a transgenic organism in our lab. We will be taking the genes from glowing organisms (jellyfish and coral) and putting them into bacteria to make GLOWING BACTERIA!
Agenda:
Thurs: Background Info (Pre-lab done in class or finished at lunch)
Fri: Lab Day (yay!)
Mon: results
Pre Lab: YOU CANNOT DO THE LAB WITHOUT A FINISHED PRE-LAB. NO EXCEPTIONS.
Title: Bacterial Transformation
Objective: To perform and observe the process of bacterial transformation
Procedure: (copy from below)
Pre-lab questions:
1.) What does the Ampicillin do? How do we know what plate has ampicillin on it?
2.) What genes or on the plasmid?
3.) What does the "+" and the "-" mean on the tubes?
In this experiment we will be creating a transgenic organism in our lab. We will be taking the genes from glowing organisms (jellyfish and coral) and putting them into bacteria to make GLOWING BACTERIA!
Agenda:
Thurs: Background Info (Pre-lab done in class or finished at lunch)
Fri: Lab Day (yay!)
Mon: results
Pre Lab: YOU CANNOT DO THE LAB WITHOUT A FINISHED PRE-LAB. NO EXCEPTIONS.
Title: Bacterial Transformation
Objective: To perform and observe the process of bacterial transformation
Procedure: (copy from below)
Pre-lab questions:
1.) What does the Ampicillin do? How do we know what plate has ampicillin on it?
2.) What genes or on the plasmid?
3.) What does the "+" and the "-" mean on the tubes?
Tuesday, December 4, 2012
Tues. Dec. 4th
PCR Results and Genetic Counseling
Agenda:
1.) Return PCR results
2.) Analysis of your DNA results
3.) Continue Gena Lab (Genetic Counseling)
Agenda:
1.) Return PCR results
2.) Analysis of your DNA results
3.) Continue Gena Lab (Genetic Counseling)
Sunday, December 2, 2012
What's up with Gena (Bioinformatiocs)
Bio- informatics Webquest
Today you and a partner will be completing a webquest that will lead you to the results of Gina's medical tests. Is your hypothesis correct? Let's find out!
Before you start:
-Make sure you wrote your groups hypothesis on the top of your worksheet.
Is Gena's type of cancer caused by genetics or something in her environment? Explain your answer.
Procedure:
Part 1:
1.) Gina had a family history of cancer, but did she get cancer from her genes or because of the environment? To test for this possibility DNA was taken and after PCR was done a gel electrophoresis was run. Go to the virtual gel electrophoresis lab. When you are done raise your hand and get credit. (Stamp on your worksheet)
Part 2:
2.) Look at Gena's DNA: (See Below)
a. Draw the gel that would result from the bands given in the link above on your worksheet. Hint: Each number represents a line on a gel for that piece of DNA.
b. Analysis of DNA electrophoresis has reviled that DNA fragments smaller than 300 base
pairs may indicate the presence of genes that have been identified in cancer research.
Does it appear from you electrophoresis model that Gena may have a cancer gene?
Explain your answer. - Write your answer next to your drawing.
Part 3:
Use Gina's DNA sequence in a BLAST search to find out what her DNA is trying to tell us.
Gina's DNA:
TAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCACACTGGA
How to run a BLAST Search:
1. Log into the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST (right side under "popular resources"
3. Under BLAST Assembled Genomes, choose the word "human"
4. In the large box enter the entire sequence from Gina's DNA (copy and paste Gena's DNA)
5. Scroll Down and click "Blast"
6. A new screen will come up. At this point you should click "View these results in the new enhanced report" (upper right hand side)
7. A new screen will appear showing you the results of the search. You should see information concerning the species and chromosome number that Gina's DNA sequence search matched (You don't have to worry about this info).
8. Scroll down to the word "Alignments" just below descriptions.
9. Under the words "Features:" you should find an important piece of information for determining if Gina's 160 base pair sequence matches any known DNA sequences. Do you see what the important clue is? If so write it down on your worksheet.
Congratulations you have finished with the BLAST search.
Complete the analysis questions on your worksheet and turn it in for you and your partner.
Finished Early? Turn in your worksheet.
- Penalty Shootout (Soccer): Reviews History and Biotech Applications
- Hoop Shoot (Basketball): Reviews History and Biotech Applications
- Grade or no Grade (Deal or No Deal): Review History and Biotech Applications
- Protein Synthesis Race :Central Dogma Review
Today you and a partner will be completing a webquest that will lead you to the results of Gina's medical tests. Is your hypothesis correct? Let's find out!
Before you start:
-Make sure you wrote your groups hypothesis on the top of your worksheet.
Is Gena's type of cancer caused by genetics or something in her environment? Explain your answer.
Procedure:
Part 1:
1.) Gina had a family history of cancer, but did she get cancer from her genes or because of the environment? To test for this possibility DNA was taken and after PCR was done a gel electrophoresis was run. Go to the virtual gel electrophoresis lab. When you are done raise your hand and get credit. (Stamp on your worksheet)
Part 2:
2.) Look at Gena's DNA: (See Below)
a. Draw the gel that would result from the bands given in the link above on your worksheet. Hint: Each number represents a line on a gel for that piece of DNA.
b. Analysis of DNA electrophoresis has reviled that DNA fragments smaller than 300 base
pairs may indicate the presence of genes that have been identified in cancer research.
Does it appear from you electrophoresis model that Gena may have a cancer gene?
Explain your answer. - Write your answer next to your drawing.
Part 3:
Use Gina's DNA sequence in a BLAST search to find out what her DNA is trying to tell us.
Gina's DNA:
TAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCACACTGGA
How to run a BLAST Search:
1. Log into the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST (right side under "popular resources"
3. Under BLAST Assembled Genomes, choose the word "human"
4. In the large box enter the entire sequence from Gina's DNA (copy and paste Gena's DNA)
5. Scroll Down and click "Blast"
6. A new screen will come up. At this point you should click "View these results in the new enhanced report" (upper right hand side)
7. A new screen will appear showing you the results of the search. You should see information concerning the species and chromosome number that Gina's DNA sequence search matched (You don't have to worry about this info).
8. Scroll down to the word "Alignments" just below descriptions.
9. Under the words "Features:" you should find an important piece of information for determining if Gina's 160 base pair sequence matches any known DNA sequences. Do you see what the important clue is? If so write it down on your worksheet.
Congratulations you have finished with the BLAST search.
Complete the analysis questions on your worksheet and turn it in for you and your partner.
Finished Early? Turn in your worksheet.
- Penalty Shootout (Soccer): Reviews History and Biotech Applications
- Hoop Shoot (Basketball): Reviews History and Biotech Applications
- Grade or no Grade (Deal or No Deal): Review History and Biotech Applications
- Protein Synthesis Race :Central Dogma Review
Friday, November 30, 2012
Wednesday, November 28, 2012
Wed. Nov. 28th
Using Biotech Skills in a Real World Scenario
Today you and your group will be given information on a person who recently went to the doctor with concerns about her health. We will discuss how PCR and Genetic Counseling is used in the real world and your group will act as doctors to try to figure out what is wrong with Gena.
HEADS UP!!!
Quiz Tomorrow on Biotech vocabulary and concepts
Today you and your group will be given information on a person who recently went to the doctor with concerns about her health. We will discuss how PCR and Genetic Counseling is used in the real world and your group will act as doctors to try to figure out what is wrong with Gena.
HEADS UP!!!
Quiz Tomorrow on Biotech vocabulary and concepts
Tuesday, November 27, 2012
Tues. Nov. 27th
Extraction of DNA from Cheek cells
Agenda:
1.) Into to using pipettes
2.) Extraction of DNA
DNA will be sent to the lab for PCR amplification.
Agenda:
1.) Into to using pipettes
2.) Extraction of DNA
DNA will be sent to the lab for PCR amplification.
Monday, November 26, 2012
Mon. Nov. 26th
Beginning Biotech Unit!
1.) New Unit = New Seats (choose wisely)
2.) Intro to biotech week
3.) DNA Extraction Pre-lab (You cannot do the lab this week if this is not done!!)
What your prelab needs to have:
Title
Objective (why are we doing this lab)
Materials: (read procedure and make a list)
Protocol (Procedure. You can copy it or summarize it)
Tomorrow's lab protocol:
1.) obtain numbered buffer/chelex tube - observe chelex beads at the bottom of the tube (record the number in your notebook)
2.) use sterile pipette tip to scrape the inside of both cheeks
3.) stick pipette tip into buffer/chelex solution and vigorousley shake cheek cells into solution
4.) place tube in white racks. once all tubes are collected place rack in hot water bath for 10 min.
5.) While samples are boiling get PCR tube from your teacher and label the top and side of the tube with the same number that was on your chelex tube.
6.) after 10 min, remove rack from water bath and place samples in centrifuge. Centrifuge for 5 minutes at 12,000rpm.
7.) transfer 5 microliters of DNA to your numbered PCR tube (avoid chelex beads)
8.) place both PCR tube and Chelex tube in rack provided.
9.) put samples on ice or in refrigerator for short term storage of the freezer for long term storage
1.) New Unit = New Seats (choose wisely)
2.) Intro to biotech week
3.) DNA Extraction Pre-lab (You cannot do the lab this week if this is not done!!)
What your prelab needs to have:
Title
Objective (why are we doing this lab)
Materials: (read procedure and make a list)
Protocol (Procedure. You can copy it or summarize it)
Tomorrow's lab protocol:
1.) obtain numbered buffer/chelex tube - observe chelex beads at the bottom of the tube (record the number in your notebook)
2.) use sterile pipette tip to scrape the inside of both cheeks
3.) stick pipette tip into buffer/chelex solution and vigorousley shake cheek cells into solution
4.) place tube in white racks. once all tubes are collected place rack in hot water bath for 10 min.
5.) While samples are boiling get PCR tube from your teacher and label the top and side of the tube with the same number that was on your chelex tube.
6.) after 10 min, remove rack from water bath and place samples in centrifuge. Centrifuge for 5 minutes at 12,000rpm.
7.) transfer 5 microliters of DNA to your numbered PCR tube (avoid chelex beads)
8.) place both PCR tube and Chelex tube in rack provided.
9.) put samples on ice or in refrigerator for short term storage of the freezer for long term storage
Friday, November 9, 2012
Fri. Nov. 9th
Exam: Genetics Part 2
This exam will cover Punett Squares, pedigree charts, inheritance patterns, and meiosis
Reminder:
Pedigree Project Final Draft is due Tuesday!!!
- Your project needs to be:
- Professional looking (look like you care and spent time on it)
- Computer Generated or a poster
- Complete: Pedigree showing 3 generations, one side of family (mom or dad's side), Numbered,
shaded in to show phenotypes, letters used to show genotype, you must be obvious (labeled),
key showing all important factors on how to read your chart,
- Stamp sheet should be attached to final project
All late project receive -10% every day its late. On time means it is in the classroom with you when the tardy bell rings. After that its late.
This exam will cover Punett Squares, pedigree charts, inheritance patterns, and meiosis
Reminder:
Pedigree Project Final Draft is due Tuesday!!!
- Your project needs to be:
- Professional looking (look like you care and spent time on it)
- Computer Generated or a poster
- Complete: Pedigree showing 3 generations, one side of family (mom or dad's side), Numbered,
shaded in to show phenotypes, letters used to show genotype, you must be obvious (labeled),
key showing all important factors on how to read your chart,
- Stamp sheet should be attached to final project
All late project receive -10% every day its late. On time means it is in the classroom with you when the tardy bell rings. After that its late.
Thursday, November 8, 2012
Thurs. Nov. 8th
Exam Review Day
Today in class you created a Study Guide for tomorrows exam.
Ch. 11 = Mendel & P. Squares (pg.332 in parrot book # 1-5 & pgs 332-333 #7-23)
Ch. 14 = Heredity/ Pedigree (pg 412 in parrot book # 1-6 & pg 415 # 8-9)
Practice Problem Worksheet
All questions above should be written in your notebook and answered for credit.
This assignment is homework if it is not completed in class today and will be checked first thing tomorrow.
Today in class you created a Study Guide for tomorrows exam.
Ch. 11 = Mendel & P. Squares (pg.332 in parrot book # 1-5 & pgs 332-333 #7-23)
Ch. 14 = Heredity/ Pedigree (pg 412 in parrot book # 1-6 & pg 415 # 8-9)
Practice Problem Worksheet
All questions above should be written in your notebook and answered for credit.
This assignment is homework if it is not completed in class today and will be checked first thing tomorrow.
Wed. Nov. 7th
Meiosis Review Day
Today we went over the steps of meiosis and practiced using play dough to show each step.
Today we went over the steps of meiosis and practiced using play dough to show each step.
Tuesday, November 6, 2012
Tues. Nov. 6th
Meiosis - Internet Lesson
In this investigation, you will view sites that illustrate the process of meiosis. For each site answer the questions associated in your notebook. YOU DO NOT NEED TO WRITE THE QUESTIONS.
Remember, you may only have half the period to do as much as possible.
Site 1 - Lew-Port's Meiosis Page
Go to Lew-Port's Meiosis Page
Answer the Following Questions in your notebook:
1. How many chromosomes does the cell in this animation start with ? __________________
2. The homologous pairs are represented by similar ________________________
3. When chromosomes make copies of themselves, they _____________________________
4. Copies of chromosomes are held together by the _____________________________
5. Each chromosome finds its __________________________________________
6. Draw "crossing over" - using your pencil to shade in the areas that exchange parts.
7. How many chromosomes are at each pole of the cell? ___________
8. During meiosis 2, chromosomes line up again along the cell's ___________________________
9. Only _________ copy of each chromosome moves toward the poles. Which means only _________ chromosomes of the original six.
10. New membranes form around each ____________________________
11. Each cell divides, forming a total of ______________ cells.
Next:
Go to meiosis Animation
Click on the animation until you reach Telophase 1 Cytokinesis. Repeat as many times as
necessary to answer questions & summarize the first stage of meiosis
1. At the start of this example how many chromosomes are in the cell? _________
2. What happens in the “S” phase to the chromosomes? _______________
3. If a chromosome replicates but remains attached does it count as one or two chromosomes?
_______________
4. What happens to the chromosomes at the end of prophase 1 that is different from mitosis?
_______________ Did you notice any trading of pieces between the red and blue____.
chromosomes? ________________
5. At which phase do the chromosomes separate? _________________
6. At the end of telophase 1 & cytokinesis what do you end up with?
Number of cells ______________ number of chromosomes in each cell? _______
Is each cell haploid or diploid? _________________. Notice again that some trading of
chromosome pieces has occurred. This is called crossing over.
Done Early:
Go to Study Games
Monday, November 5, 2012
Mon. Nov. 5th
Meiosis
Agenda:
1.) Warm Up
2.) HW/ Project part B check
3.) Meiosis Chart (Homework if not done)
-Go to Meiosis Website to help finish chart
4.) Project Part C check
Agenda:
1.) Warm Up
2.) HW/ Project part B check
3.) Meiosis Chart (Homework if not done)
-Go to Meiosis Website to help finish chart
4.) Project Part C check
Thursday, November 1, 2012
Thurs. Nov. 1st
Pedigree Practice and Projects
Agenda:
1.) Warm Up
2.) Practice Pedigrees (Done in Notebook and Stamped)
Pedigree Practice Questions: (Copied twice for 1 & 2
Answer the questions about the pedigree chart below.
What is the pattern of inheritance depicted? __________________________
WHY are the other patterns ruled out?
Write the genotypes for all individuals --use "A" to represent a dominant allele & "a" to represent a recessive allele, if one allele is unknown, use a "?" to represent that allele.
Generation #1 -
Generation #2 -
Generation #3 -
3.) Project Info.
Homework:
Ped. Project Part A (Due when you get to class)
1.) Trait:_________________ (choose a trait to study in your family)
2.) Are you studying your mom or dad's side of the family
3.) Make a list for 3 generations (grandparents, parents, you) include all cousins, aunts and uncles for 1 side of family. Try to give the info for everyone if they have the trait or not?
Agenda:
1.) Warm Up
2.) Practice Pedigrees (Done in Notebook and Stamped)
Pedigree Practice Questions: (Copied twice for 1 & 2
Answer the questions about the pedigree chart below.
What is the pattern of inheritance depicted? __________________________
WHY are the other patterns ruled out?
Write the genotypes for all individuals --use "A" to represent a dominant allele & "a" to represent a recessive allele, if one allele is unknown, use a "?" to represent that allele.
Generation #1 -
Generation #2 -
Generation #3 -
3.) Project Info.
Homework:
Ped. Project Part A (Due when you get to class)
1.) Trait:_________________ (choose a trait to study in your family)
2.) Are you studying your mom or dad's side of the family
3.) Make a list for 3 generations (grandparents, parents, you) include all cousins, aunts and uncles for 1 side of family. Try to give the info for everyone if they have the trait or not?
Tuesday, October 30, 2012
Tues. Oct. 30th
pedigree charts
Agenda:
1.) Review Quiz (from Friday)
2.) Pedigree Chart Notes
3.) Practice pedigree Problems
Agenda:
1.) Review Quiz (from Friday)
2.) Pedigree Chart Notes
3.) Practice pedigree Problems
Mon. Oct. 29th
Chapter Review:
Chapter reviews for chapter 11 was completed in class today. If you were absent you will need to come in at lunch on tues/thurs during tutoring to make it up.
Chapter reviews for chapter 11 was completed in class today. If you were absent you will need to come in at lunch on tues/thurs during tutoring to make it up.
Friday, October 26, 2012
Thursday, October 25, 2012
Quiz Study Games
Tomorrows Quiz will cover DNA structure (all review to see what you remember) and Punnett Squares. The punnett Square portion will count as double that of the DNA stuff.
The following are links to games to help you study for the quiz:
- Punnett Square shoot out (Basketball punnett square game)
- Wild Wild Taxi
- Outter Space attacker
The following are links to games to help you study for the quiz:
- Punnett Square shoot out (Basketball punnett square game)
- Wild Wild Taxi
- Outter Space attacker
Thurs. Oct. 25th
Determining Genotypes from Phenotypes Lab
Today in class you should have completed:
1.) A PTC test as a class
2.) Determining your genotypes using the procedure in the lab manual
3.) Filled out your data table in your notebook
4.) Finished answering all analysis questions for the lab
5.) gotten a completion stamp for finishing everything
Today in class you should have completed:
1.) A PTC test as a class
2.) Determining your genotypes using the procedure in the lab manual
3.) Filled out your data table in your notebook
4.) Finished answering all analysis questions for the lab
5.) gotten a completion stamp for finishing everything
Wednesday, October 24, 2012
Tues/ Wed (Oct. 23-24)
Complex Traits and Punnet Squares
Agenda:
1.) Simpson Genetics Probability Worksheet (Turned in at end of class)
2.) "The Homer Simpson Gene" Article
3.) The Animated version of the Simpson gene & genetics questions
4.) Set up Lab For Thursdays lab
Heads Up!!!!
Quiz Friday on Punnett Squares and DNA
Agenda:
1.) Simpson Genetics Probability Worksheet (Turned in at end of class)
2.) "The Homer Simpson Gene" Article
3.) The Animated version of the Simpson gene & genetics questions
4.) Set up Lab For Thursdays lab
Heads Up!!!!
Quiz Friday on Punnett Squares and DNA
Monday, October 22, 2012
Mon. Oct. 22nd
Complex Inheritance
Agenda:
1.) Check/ correct/ collect homework
2.) Complex inheritance notes
Heads Up!!!!
Quiz on Punnett Squares This Friday!!!
Agenda:
1.) Check/ correct/ collect homework
2.) Complex inheritance notes
Heads Up!!!!
Quiz on Punnett Squares This Friday!!!
Fri. Oct.19th
Examples of Incomplete Dominance
If you were absent please watch the video and answer the questions below.
Agenda:
1.) Secrets of the Dead (Plague Genetics)
- Worksheet (Due Monday)
- Page 1
- Page 2
- Video Clips
If you were absent please watch the video and answer the questions below.
Agenda:
1.) Secrets of the Dead (Plague Genetics)
- Worksheet (Due Monday)
- Page 1
- Page 2
- Video Clips
Thursday, October 18, 2012
Thurs. Oct. 18th
Monster Match Lab
Agenda:
1.) Turn in Sponge Bob Packet
2.) Monster Match Lab Instructions
3.) Lab Time
Monster Match Questions: DUE TOMORROW!!!
1. Use a Punnett square to show the possible offspring of a cross between two organisms
heterozygous for a trait. Use A and a to represent the alleles.
2. Based on your Punnett square, it is more probable that the offspring will show the dominant
trait or the recessive trait? Explain your answer.
3. Give an example from the activity of a heterozygous genotype. _________
4. List at least three traits for which your monster was heterozygous.
5. Give an example from the activity of a homozygous dominant genotype. _________
6. List at least three traits for which your monster was homozygous dominant.
7. Give an example from the activity of a homozygous recessive genotype. _________
8. List at least three traits for which your monster was homozygous recessive
9. Using an example from the activity, describe the difference between genotype and
phenotype.
Agenda:
1.) Turn in Sponge Bob Packet
2.) Monster Match Lab Instructions
3.) Lab Time
Monster Match Questions: DUE TOMORROW!!!
1. Use a Punnett square to show the possible offspring of a cross between two organisms
heterozygous for a trait. Use A and a to represent the alleles.
2. Based on your Punnett square, it is more probable that the offspring will show the dominant
trait or the recessive trait? Explain your answer.
3. Give an example from the activity of a heterozygous genotype. _________
4. List at least three traits for which your monster was heterozygous.
5. Give an example from the activity of a homozygous dominant genotype. _________
6. List at least three traits for which your monster was homozygous dominant.
7. Give an example from the activity of a homozygous recessive genotype. _________
8. List at least three traits for which your monster was homozygous recessive
9. Using an example from the activity, describe the difference between genotype and
phenotype.
Wednesday, October 17, 2012
Tuesday, October 16, 2012
Tues. Oct. 16th
Monday, October 15, 2012
Thursday, October 11, 2012
Thurs./ Fri. (Oct. 11-12)
Dog Genetics
Did dogs evolve from wolves because we chose them or did they choose to live with us? We will look at two hypotheses for the domestication of dogs.
Agenda:
Thursday: Background info
Friday: From wolf to Dog Lab
Each day will earn 2 participation points. These points will be the last points for the 6-week grading period.
Did dogs evolve from wolves because we chose them or did they choose to live with us? We will look at two hypotheses for the domestication of dogs.
Agenda:
Thursday: Background info
Friday: From wolf to Dog Lab
Each day will earn 2 participation points. These points will be the last points for the 6-week grading period.
Wednesday, October 10, 2012
Tuesday, October 9, 2012
Help!
I don't understand this Transcription and translation stuff!
This video may help: Bozeman Science Video
-(some info may be more advanced then what we did in class)
This game might help too!
Link to game
This video may help: Bozeman Science Video
-(some info may be more advanced then what we did in class)
This game might help too!
Link to game
Tues. Oct. 9th
Exam Review
Today in class we worked on the Assessment Questions for tomorrows exam on Transcription and Translation. You should use these questions as a study guide to help you review for the test.
You must copy the questions and give the correct answer for credit.
This was a stamped assignment. If you did not finish in class it is homework.
Assessment Questions:
Pg. 386 # 1-6 & 8-13
1.) The process by which the genetic code of DNA is copied into a strand of DNA IS CALLED
a. translation
b. transcription
c. transformation
d. replication
2.) Which of the following describes RNA?
a. RNA is usually double-stranded and contains the base thymine
b. RNA is usually single stranded- and contains the base uracil
c. RNA is longer than DNA and uses five bases to encode information
d. RNA is made in the nucleus of eukaryotic cells and stays there to carry out its function
3.) Describe the function of each of the the three types of RNA
4.) How does the enzyme that makes RNA know where to start transcribing the DNA?
5.) Compare introns and exons.
6.) (answer only ok) Suppose you start with the NA strand ACCGTCAC. Use the rules of base pairing to list the bases on a mRNA strand transcribed from this DNA strand.
8.) In mRNA, each codon specifies a particular
a. nucleotide
b. enzyme
c. amino acid
d. promoter
9.) The number of codons in the genetic code is
a. 3
b. 4
c. 20
d. 64
10.) Which of the following is true about the genetic code?
a. a codon can specify more than 1 amino acid
b. every codon specifies a different amino acid
c. some codons specify the same amino acid
d. some codons have no function at all
11.) The process of making proteins in the ribosome based on instructions from mRNA is called
a. transcription
b. transformation
c. translation
d. molecular biology
12.) What is a codon?
13.) How do anticodons function
Pg. 389 # 1-4
1.) How does RNA differ from DNA?
a. RNA contains uracil and deoxyribose
b. RNA contains ribose and thymine
c. RNA contains uracil and ribose
d. RNA contains adenine and ribose
2.) How would the DNA sequence GCTATA
a. GCUAUA
b. CGATAT
c. CGAUAU
d. GCUTUT
3-4 Use codon chart
3.) Which of the following codons signifies the end of translation?
a. CAA
b. UGA
c. AUC
d. CCA
4. ) Which chains of amino acids correspond the nucleotide sequence UCAAGCGUA?
a. gly-cys-pro
b. glu-asp-stop
c. thr-arg-met
d. ser-ser-val
Today in class we worked on the Assessment Questions for tomorrows exam on Transcription and Translation. You should use these questions as a study guide to help you review for the test.
You must copy the questions and give the correct answer for credit.
This was a stamped assignment. If you did not finish in class it is homework.
Assessment Questions:
Pg. 386 # 1-6 & 8-13
1.) The process by which the genetic code of DNA is copied into a strand of DNA IS CALLED
a. translation
b. transcription
c. transformation
d. replication
2.) Which of the following describes RNA?
a. RNA is usually double-stranded and contains the base thymine
b. RNA is usually single stranded- and contains the base uracil
c. RNA is longer than DNA and uses five bases to encode information
d. RNA is made in the nucleus of eukaryotic cells and stays there to carry out its function
3.) Describe the function of each of the the three types of RNA
4.) How does the enzyme that makes RNA know where to start transcribing the DNA?
5.) Compare introns and exons.
6.) (answer only ok) Suppose you start with the NA strand ACCGTCAC. Use the rules of base pairing to list the bases on a mRNA strand transcribed from this DNA strand.
8.) In mRNA, each codon specifies a particular
a. nucleotide
b. enzyme
c. amino acid
d. promoter
9.) The number of codons in the genetic code is
a. 3
b. 4
c. 20
d. 64
10.) Which of the following is true about the genetic code?
a. a codon can specify more than 1 amino acid
b. every codon specifies a different amino acid
c. some codons specify the same amino acid
d. some codons have no function at all
11.) The process of making proteins in the ribosome based on instructions from mRNA is called
a. transcription
b. transformation
c. translation
d. molecular biology
12.) What is a codon?
13.) How do anticodons function
Pg. 389 # 1-4
1.) How does RNA differ from DNA?
a. RNA contains uracil and deoxyribose
b. RNA contains ribose and thymine
c. RNA contains uracil and ribose
d. RNA contains adenine and ribose
2.) How would the DNA sequence GCTATA
a. GCUAUA
b. CGATAT
c. CGAUAU
d. GCUTUT
3-4 Use codon chart
3.) Which of the following codons signifies the end of translation?
a. CAA
b. UGA
c. AUC
d. CCA
4. ) Which chains of amino acids correspond the nucleotide sequence UCAAGCGUA?
a. gly-cys-pro
b. glu-asp-stop
c. thr-arg-met
d. ser-ser-val
Monday, October 8, 2012
Mon. Oct 8th
Agenda:
1.) Grade Check
2.) Finish Cracking the Code Video/ Turn in Questions
3.) Test corrections (1/2 point for every answer corrected in the proper format)
HEADS UP!!!!
Exam this Wednesday
- DNA
- RNA (all types)
- DNA Replication
- Transcription
- Translation
1.) Grade Check
2.) Finish Cracking the Code Video/ Turn in Questions
3.) Test corrections (1/2 point for every answer corrected in the proper format)
HEADS UP!!!!
Exam this Wednesday
- DNA
- RNA (all types)
- DNA Replication
- Transcription
- Translation
Tuesday, October 2, 2012
This Week (Oct 1-5)
Monday: Transcription Review and The Genetic Code Notes
Tuesday: Translation Notes (Gold Foldable notes)
Wednesday: Transcription through Translation Review
Homework: Complete the Transcription translation Worksheet
Thursday: Cracking the Code of Life
Friday: Cracking the Code of Life (Pep Rally Day)
Tuesday: Translation Notes (Gold Foldable notes)
Wednesday: Transcription through Translation Review
Homework: Complete the Transcription translation Worksheet
Thursday: Cracking the Code of Life
Friday: Cracking the Code of Life (Pep Rally Day)
Friday, September 28, 2012
Thurs. Sept. 27th
Transcription and Translation
agenda:
1.) Warm Up
2.) Transcription notes
3.) Set up and collect notebooks for corrections
-Notebooks will be graded tomorrow in class!
agenda:
1.) Warm Up
2.) Transcription notes
3.) Set up and collect notebooks for corrections
-Notebooks will be graded tomorrow in class!
Wednesday, September 26, 2012
Wed. Sept. 26th
RNA vs DNA
Agenda:
1.) Warm Up
2.) Notes: RNA vs DNA
3.) Assessment #1 (DNA)
Assessment Questions
Pg. 356 # 9-12
9.) A nucleotide does not contain
a. a 5-carbon sugar
b. an amino acid
c. a nitrogen base
d. a phosphate group
10.) According to Chargoff's rule of base pairing which of the following is true about dna?
a. A=T, & C=G
b. A=C & T=G
c. A=G & T=C
d. A=T=C=G
11.) The bonds that hold the two strands of DNA together came from
a. the attraction of phosphate groups for each other
b. strong bonds between nitrogenous bases and the sugar phosphate backbone
c. weak hydrogen bonds between nitorgenous bases
d. carbon-to-carbon bonds in the sugar portion of the nucleotides
12.) Describe the components and structure of a DNA nucleotide.
Pg. 357 # 20, 21, 22, 24
20.) the diagram below shows the process of
a. replication
b. digestion
c. transformation
d. transporation
21.) the main enzyme involved in linking individual nucleotides into DNA molecules is
a. DNA protease
b. ribose
c. carbohydrate
d. DNA polymerase
22.) What is meant by the term base pairing? How is base pairing involved in DNA replication?
24.) Explain the process of replication. When a DNA molecule is replicated, how do the new molecules compare to the original molecule?
Pg. 359 # 1, 3, 5, 9, 10
1.) During replication, which sequence of nucleotides would bond with the DNA sequence TATGA?
a. TATGA
b. ATACT
c. CACTA
d. AGTAT
3.) Which of the following does not describe the structure of DNA?
a. double helix
b. nucleotide polymer (made of many smaller pieces)
c. contains adenine and guanine pairs
d. sugar-phosphate backbone
5.) The two "backbones" of the DNA molecule consists of
a. adenine and sugars
b. phosphates and sugars
c. adenines and thymines
d. thymines and sugars
9.) How many cells are present after 80 minutes?
a. 1
b. 2
c. 16
d. 32
10.) If the DNA of the bacterium is 4 million base pairs in length, how many total molecules of A,T, C and G are required for replication?
a. 2 million
b. 4 million
c. 8 million
d. 32 million
Agenda:
1.) Warm Up
2.) Notes: RNA vs DNA
3.) Assessment #1 (DNA)
Assessment Questions
Pg. 356 # 9-12
9.) A nucleotide does not contain
a. a 5-carbon sugar
b. an amino acid
c. a nitrogen base
d. a phosphate group
10.) According to Chargoff's rule of base pairing which of the following is true about dna?
a. A=T, & C=G
b. A=C & T=G
c. A=G & T=C
d. A=T=C=G
11.) The bonds that hold the two strands of DNA together came from
a. the attraction of phosphate groups for each other
b. strong bonds between nitrogenous bases and the sugar phosphate backbone
c. weak hydrogen bonds between nitorgenous bases
d. carbon-to-carbon bonds in the sugar portion of the nucleotides
12.) Describe the components and structure of a DNA nucleotide.
Pg. 357 # 20, 21, 22, 24
20.) the diagram below shows the process of
a. replication
b. digestion
c. transformation
d. transporation
21.) the main enzyme involved in linking individual nucleotides into DNA molecules is
a. DNA protease
b. ribose
c. carbohydrate
d. DNA polymerase
22.) What is meant by the term base pairing? How is base pairing involved in DNA replication?
24.) Explain the process of replication. When a DNA molecule is replicated, how do the new molecules compare to the original molecule?
Pg. 359 # 1, 3, 5, 9, 10
1.) During replication, which sequence of nucleotides would bond with the DNA sequence TATGA?
a. TATGA
b. ATACT
c. CACTA
d. AGTAT
3.) Which of the following does not describe the structure of DNA?
a. double helix
b. nucleotide polymer (made of many smaller pieces)
c. contains adenine and guanine pairs
d. sugar-phosphate backbone
5.) The two "backbones" of the DNA molecule consists of
a. adenine and sugars
b. phosphates and sugars
c. adenines and thymines
d. thymines and sugars
9.) How many cells are present after 80 minutes?
a. 1
b. 2
c. 16
d. 32
10.) If the DNA of the bacterium is 4 million base pairs in length, how many total molecules of A,T, C and G are required for replication?
a. 2 million
b. 4 million
c. 8 million
d. 32 million
Tuesday, September 25, 2012
Monday, September 24, 2012
Mon. Sept. 24th
DNA Replication
Agenda:
1.) Warm Up
2.) DNA Replication Foldable (Notes)
Homework:
-Memorize the steps in DNA Replication for a quiz tomorrow in class
Agenda:
1.) Warm Up
2.) DNA Replication Foldable (Notes)
Homework:
-Memorize the steps in DNA Replication for a quiz tomorrow in class
Friday, September 14, 2012
Project #1 Due Tuesday Sept.
Pill Bug Lab Report
Your First Project of the year is a typed lab report on the Pill Bug Lab conducted in class.
Format:
Typed (graphs and tables should be computer generated)
Size 12 font, single space, Times New Roman
***Bold = should be written exactly as a heading in your report***
Page 1: Title Page (you can use different font and size here to be creative)
- Title of Lab
- your name
- Date Written
- Period
- Picture (not required but makes it nice)
Page 2-3 (more may be possible)
Title: Write out the title of the lab from your notes
Purpose: Copy the objectives from your notes
Materials: Copy materials list from your notes
Procedure:
Experiment 1: Write out a detailed, numbered, step-by-step procedure for experiment 1
Experiment 2: Write out a detailed, numbered, step-by-step procedure for experiment 2
Data:
Experiment 1: Should include qualitative and quantitative data you observed (a list is fine as long
as you label which is the qualitative stuff and which is quantitative)
Experiment 1 also should include a computer generated data table of pill bug
measurements (from class) and a computer generated graph of the same table
Experiment 2: Should include a computer generated data table of you response (time rolled in
a ball) experiment and a computer generated graph of the same data
Conclusion: Multiple paragraphs in a mini-essay format
Paragraph 1: Introduction.Introduce the pill bug. Do a little internet research to help you explain how the pill bug meets all 7 characteristics of life. Make sure you talk about each characteristic (RARE HOG) of life and explain how your bug showed the characteristics either in your reserch or lab.
Supporting Paragraph(s): Explain your experiments. Talk about your experiments and how they tested the characteristics of life (RARE HOG). This paragraph(s) is also where you would rewrite your analysis questions in an essay format so that they and the answers flow with your essay.
Final Paragraph: Final Conclusions. Summarize what you learned from this experiment. Restate your objectives and explain your objectives and explain how you accomplished your goals for meeting your objectives.
Your First Project of the year is a typed lab report on the Pill Bug Lab conducted in class.
Format:
Typed (graphs and tables should be computer generated)
Size 12 font, single space, Times New Roman
***Bold = should be written exactly as a heading in your report***
Page 1: Title Page (you can use different font and size here to be creative)
- Title of Lab
- your name
- Date Written
- Period
- Picture (not required but makes it nice)
Page 2-3 (more may be possible)
Title: Write out the title of the lab from your notes
Purpose: Copy the objectives from your notes
Materials: Copy materials list from your notes
Procedure:
Experiment 1: Write out a detailed, numbered, step-by-step procedure for experiment 1
Experiment 2: Write out a detailed, numbered, step-by-step procedure for experiment 2
Data:
Experiment 1: Should include qualitative and quantitative data you observed (a list is fine as long
as you label which is the qualitative stuff and which is quantitative)
Experiment 1 also should include a computer generated data table of pill bug
measurements (from class) and a computer generated graph of the same table
Experiment 2: Should include a computer generated data table of you response (time rolled in
a ball) experiment and a computer generated graph of the same data
Conclusion: Multiple paragraphs in a mini-essay format
Paragraph 1: Introduction.Introduce the pill bug. Do a little internet research to help you explain how the pill bug meets all 7 characteristics of life. Make sure you talk about each characteristic (RARE HOG) of life and explain how your bug showed the characteristics either in your reserch or lab.
Supporting Paragraph(s): Explain your experiments. Talk about your experiments and how they tested the characteristics of life (RARE HOG). This paragraph(s) is also where you would rewrite your analysis questions in an essay format so that they and the answers flow with your essay.
Final Paragraph: Final Conclusions. Summarize what you learned from this experiment. Restate your objectives and explain your objectives and explain how you accomplished your goals for meeting your objectives.
Friday Sept. 14th
Beginning of Genetics Unit: History
Agenda:
1.) Stamp Vocab Definitions (Last Nights Homework**)
2.) Start Video: Secret Photo 51 (Video Questions passed out)
**Due to confusion over definitions the Vocabulary Due Date has been pushed back to MONDAY.
Agenda:
1.) Stamp Vocab Definitions (Last Nights Homework**)
2.) Start Video: Secret Photo 51 (Video Questions passed out)
**Due to confusion over definitions the Vocabulary Due Date has been pushed back to MONDAY.
Thursday, September 13, 2012
Thurs. Sept. 13th
End of Chapter 1 & Beginning Genetics Unit
Agenda:
1.) Check Lab Analysis
2.) Vocab Quiz (If you were absent you will need to make this up when you get back)
3.) Pill Bug Lab Report (Project Info) - Due Next Tuesday!!!
4.) Genetics Vocab Work Time ( Homework if not done!!)
Genetics Vocab:
1. Genetics
2. fertilization
3. trait
4. hybrid
5. gene
6. allele
7. gamete
8. Principle of Dominance
9. Segregation
10. Probability
11. Homozygous
12. Heterozygous
13. Phenotype
14. Genotype
15. Base Pairing
16. replication
17. DNA Polymerase
18. RNA
19. messenger RNA
20. ribosomal RNA
21. transfer RNA
22. nucleotide
23. Transcription
24. RNA polymerase
25. intron
26. Exon
27. protein
28. enzyme
29. translation
19.
Agenda:
1.) Check Lab Analysis
2.) Vocab Quiz (If you were absent you will need to make this up when you get back)
3.) Pill Bug Lab Report (Project Info) - Due Next Tuesday!!!
4.) Genetics Vocab Work Time ( Homework if not done!!)
Genetics Vocab:
1. Genetics
2. fertilization
3. trait
4. hybrid
5. gene
6. allele
7. gamete
8. Principle of Dominance
9. Segregation
10. Probability
11. Homozygous
12. Heterozygous
13. Phenotype
14. Genotype
15. Base Pairing
16. replication
17. DNA Polymerase
18. RNA
19. messenger RNA
20. ribosomal RNA
21. transfer RNA
22. nucleotide
23. Transcription
24. RNA polymerase
25. intron
26. Exon
27. protein
28. enzyme
29. translation
19.
Wednesday, September 12, 2012
Wed. Sept. 12th
Pill Bug Lab Analysis Day
Agenda:
1.) Today's checklist (Go over what is due today)
2.) Data Analysis of Pill Bug Lab
3.) Analysis Questions
New Vocab :
* Qualitiative: Data that includes observations or qualities
* Quantitative: Data that includes numbers
Today's Check List (This is what you should have finished today in class)
- Graph size of pill bug data from yesterday
- Calculate average size of pill bug (show your work)
all class bug sizes added up
Average size = ----------------------------------
total number of bugs
- Graph time rolled up into a ball chart from yesterday
- Start a New Section in your Lab. Title it "Analysis
- In your new analysis section write the QUESTIONS and the Answers toy questions 1-5 in the lab.
Laboratory Questions:
2. Which characteristic(s) of life did the drawings help you to identify?
3. Which characteristic(s) of life did experiment 1 help you to identify?
4. Which characteristic(s) of life did the response time chart help you to identify?
5. Which characteristic(s) of life have you not observed in the pill bugs at this time?
(Characteristics of Life = RARE HOG notes from yesterday)
Get a stamp when all the above is completed (Stamps will be available tomorrow as well)
Agenda:
1.) Today's checklist (Go over what is due today)
2.) Data Analysis of Pill Bug Lab
3.) Analysis Questions
New Vocab :
* Qualitiative: Data that includes observations or qualities
* Quantitative: Data that includes numbers
Today's Check List (This is what you should have finished today in class)
- Graph size of pill bug data from yesterday
- Calculate average size of pill bug (show your work)
all class bug sizes added up
Average size = ----------------------------------
total number of bugs
- Graph time rolled up into a ball chart from yesterday
- Start a New Section in your Lab. Title it "Analysis
- In your new analysis section write the QUESTIONS and the Answers toy questions 1-5 in the lab.
Laboratory Questions:
- Which characteristic(s) of life did the, quantitative & qualitative observations help you to identify?
2. Which characteristic(s) of life did the drawings help you to identify?
3. Which characteristic(s) of life did experiment 1 help you to identify?
4. Which characteristic(s) of life did the response time chart help you to identify?
5. Which characteristic(s) of life have you not observed in the pill bugs at this time?
(Characteristics of Life = RARE HOG notes from yesterday)
Get a stamp when all the above is completed (Stamps will be available tomorrow as well)
Tuesday, September 11, 2012
Tues. Sept. 11th
Characteristics of life
Agenda:
1.) Warm Up
2.) Notes: Characteristics of life
3.) Collect Data for Pill Bug Lab
HEADS UP!!!
Quiz on Vocabulary this THURSDAY
Agenda:
1.) Warm Up
2.) Notes: Characteristics of life
3.) Collect Data for Pill Bug Lab
HEADS UP!!!
Quiz on Vocabulary this THURSDAY
Monday, September 10, 2012
Extra Credit!!!
EXTRA CREDIT!!!!
- Monday and Tuesday (Monday - anytime. Tuesday - before school only) bring in Roly Poly bugs for our lab on Tuesday.
- You get credit only for real LIVING roly poly bugs. More bugs = more points!
- Make sure you have real roly polys by using the following pictures as a guide:
- Monday and Tuesday (Monday - anytime. Tuesday - before school only) bring in Roly Poly bugs for our lab on Tuesday.
- You get credit only for real LIVING roly poly bugs. More bugs = more points!
- Make sure you have real roly polys by using the following pictures as a guide:
![]() |
| Not a Pill Bug/ Roly Poly |
![]() |
| Roly Poly/ Pill Bug |
Mon. Sept. 10th
Agenda:
1.) Finish Checks Lab - Stamped for Credit
2.) Checks Lab Questions
3.) Pill Bug Lab Report (Pre-lab Set up)
Homework:
- If you did not finish your pill bug prelab its homework and DUE TOMORROW!
Link to Pill Bug Lab
What to do:
- In your notebook you will need the following:
Title: Pill Bug Lab (Collecting Biological Data)
Objective: 1. Observe the Characteristics of Life in a pill Bug
2. Follow scientific method to create a lab report
Materials: (Copy from lab procedure)
Procedure:
Experiment 1: Copy or summarize from lab procedure
Experiment 2: Copy or summarize from lab procedure
** we will no be doing experiment 3**
1.) Finish Checks Lab - Stamped for Credit
2.) Checks Lab Questions
3.) Pill Bug Lab Report (Pre-lab Set up)
Homework:
- If you did not finish your pill bug prelab its homework and DUE TOMORROW!
Link to Pill Bug Lab
What to do:
- In your notebook you will need the following:
Title: Pill Bug Lab (Collecting Biological Data)
Objective: 1. Observe the Characteristics of Life in a pill Bug
2. Follow scientific method to create a lab report
Materials: (Copy from lab procedure)
Procedure:
Experiment 1: Copy or summarize from lab procedure
Experiment 2: Copy or summarize from lab procedure
** we will no be doing experiment 3**
Friday, September 7, 2012
Fri. Sept. 7th
Agenda:
1.) Warm Up #1 (See notes below)
2.) Scientific Methods Notes (Today we went through Hypothesis in most classes)
3.) Start Checks Lab
EXTRA CREDIT!!!!
- Monday and Tuesday (Monday - anytime. Tuesday - before school only) bring in Roly Poly bugs for our lab on Tuesday.
- You get credit only for real LIVING roly poly bugs. More bugs = more points!
- Make sure you have real roly polys by using the following pictures as a guide:
1.) Warm Up #1 (See notes below)
2.) Scientific Methods Notes (Today we went through Hypothesis in most classes)
3.) Start Checks Lab
EXTRA CREDIT!!!!
- Monday and Tuesday (Monday - anytime. Tuesday - before school only) bring in Roly Poly bugs for our lab on Tuesday.
- You get credit only for real LIVING roly poly bugs. More bugs = more points!
- Make sure you have real roly polys by using the following pictures as a guide:
![]() |
| Not a Pill Bug/ Roly Poly |
![]() | |
| Roly Poly/ Pill Bug |
Still having trouble getting the Safety Contract?
Some of you have been having trouble getting the link for the safety contract to work on your personal computers. Here is a website with a different link.
Link to Flinn Science Safety Contract
Link to Flinn Science Safety Contract
Thurs. Sept. 6th
Mrs Spendlove was absent today. In class you should have:
1.) Finished the Scientific Methods Vocabulary (See Below for list)
2.) Completed the Scientific Methods in Action Worksheet
** Don't forget to add each assignment into you Table of Contents**
* If you didn't finish it in class finish it as homework*
Scientific Methods Vocabulary:
1. observation
2. inference
3. hypothesis
4. controlled experiment
5. independent variable
6. dependent variable
7. control group
8. data
9. theory
10. biology
11. DNA (deoxyribonucleic acid)
12. stimulus
13. homeostasis
14. metabolism
15. biosphere
1.) Finished the Scientific Methods Vocabulary (See Below for list)
2.) Completed the Scientific Methods in Action Worksheet
** Don't forget to add each assignment into you Table of Contents**
* If you didn't finish it in class finish it as homework*
Scientific Methods Vocabulary:
1. observation
2. inference
3. hypothesis
4. controlled experiment
5. independent variable
6. dependent variable
7. control group
8. data
9. theory
10. biology
11. DNA (deoxyribonucleic acid)
12. stimulus
13. homeostasis
14. metabolism
15. biosphere
Wednesday, September 5, 2012
Wed. Sept. 5th
Agenda:
1.) Notebook Check/ Homework Collection
2.) Set Up Notebooks
3.) Review Safety
4.) Safety Quiz
5.) Start Ch. 1 Vocabulary (Will complete tomorrow in class)
1.) Notebook Check/ Homework Collection
2.) Set Up Notebooks
3.) Review Safety
4.) Safety Quiz
5.) Start Ch. 1 Vocabulary (Will complete tomorrow in class)
Thursday, August 30, 2012
Welcome to Biology!
Homework Assignments:
1.) Syllabus
a. Read Syllabus
b. Have parents read syllabus
c. Print out Parent Signature Slip and Contact sheet (Turn in Tomorrow)
2.) Purchase a Composition Book for Tomorrow (We will set these up in class tomorrow!)
- Spiral Bound Notebooks will not be accepted for points
- You will loose 10% for this grade every day its late.
3.) Print out The Safety Contract & Study for Safety Quiz
- Quiz tomorrow!
- This will be your first Exam/Quiz Grade
- Turn in Safety Contract Tomorrow in Class
1.) Syllabus
a. Read Syllabus
b. Have parents read syllabus
c. Print out Parent Signature Slip and Contact sheet (Turn in Tomorrow)
2.) Purchase a Composition Book for Tomorrow (We will set these up in class tomorrow!)
- Spiral Bound Notebooks will not be accepted for points
- You will loose 10% for this grade every day its late.
3.) Print out The Safety Contract & Study for Safety Quiz
- Quiz tomorrow!
- This will be your first Exam/Quiz Grade
- Turn in Safety Contract Tomorrow in Class
Subscribe to:
Posts (Atom)


















